 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circEIF4G2 | |||
| Gene | EIF4G2 | Organism | Human |
| Genome Locus | Build | hg19 | |
| Disease | Cervical Cancer | ICD-10 | Malignant neoplasm of cervix uteri (C53) |
| DBLink | PMID | 30896864 | |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | 20 pairs of CC tissues and adjacent normal tissues |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TTTTTCAACAAAGCAAGGTCAA ReverseTCTAGGTCCCACTGTCCTCA | Statistics | Fold Change : Upregulated pvalue : <0.05 |
| Citation | |||
| Mao, Y, Zhang, L, Li, Y (2019). circEIF4G2 modulates the malignant features of cervical cancer via the miR"‘218/HOXA1 pathway. Mol Med Rep, 19, 5:3714-3722. | |||